Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00015

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00015:

Expression details for Contig15_s_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig15_s_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os12g37910.2, GDSL-like lipase/acylhydrolase, putative, expressed, Expect:9e-33, match=77/180. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi5g02080.1, , Expect:2e-56, match=104/174. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 NP_200316.1 3e-15 GDSL-motif lipase/hydrolase-like protein; protein id: At5g55050.1, supported by cDNA: gi_18175651 [Arabidopsis thaliana]
Annotation via Blast BLASTX UniProt: UniRef90_Q9FIA1, GDSL esterase/lipase At5g55050 n=2 Tax=Arabidopsis RepID=GDL87_ARATH, Expect:3e-14, match=52/166. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA29806_4513, , Expect:0, match=818/818. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: NP_001130085, hypothetical protein LOC100191178 [Zea mays], Expect:3e-49, match=96/168. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os12g37910.2, GDSL-like lipase/acylhydrolase, putative, expressed, Expect:9e-33, match=77/180. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC212366, , Expect:0, match=865/807. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi5g02080.1, , Expect:2e-56, match=104/174. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT5G55050.1, | Symbols: | GDSL-like Lipase/Acylhydrolase superfamily protein | chr5:22337745-22339741 FORWARD LENGTH=377, Expect:6e-16, match=52/166. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 869
>Barley1_00015
GTCAAGATGGTCACCACCTACATCGAGCACATCCAGGCGCTCTACGACATGGGAGCGCGC
ATGGTGGGGATCCTCGACGTGCCGCCGATCGGGTGCACGCCGGGGCAGCGGGCCGGCATG
CCCAACGGCGAGTGCAACCAGCAGGCCAACTCCCTGGCGCAGGCGTTCAACGGCCTCCTC
AGGGCCAAGCTCGCCGAGGCCGCAGCCGCCACCATGAAGGAGCTCAAGTACTCCGTCGCC
GCCAACTACAACATCCTCAACGAGATGATGGACAACTCGCTCGTAGCCGGGCTGAGGCAC
GTGAAGACGGCGTGCTGCGGCTCCGGGAAGCTCAACGCGGAGGTGATGTGCAGCCACCCG
GGCACGACGGCGTGCCCCGCCGCCGACCACGATGACTACATGTTCTGGGACATGCTCCAC
CCCACGCACGCCACCATCCAACGCGGCGTCGTCGCCTTCTTCTACGGCAACGGACCCAAG
TACGGCGAGCCCGTCAACTTCGCCACGCTCGTCACGGGCAAGAACGAATCTCCTGCGATC
AAGATGGTCGTCGCCGACGAGTAAACAATGGATGGCATGCATGATGCATGTGCACGTGCA
TTTGGAATGGCCGTACGCCGTCTGTTCCTACGTATAAGATGTTTTAACAGTTTAATTTGA
AACTGCCAAAACATCTTGTACTTTTAAAAACAGAGGCAGTACTAGATAATAAGTGTGTTA
TTTTCACGTTATTGTTCCGTACGTGCAACTAGCTCGATCTCTTGTTGTGTTTTGCCCTTC
GATTACTATGTGAATGTAATAAAGCAGTTTTGCTGGACAAAAAAAAAAAAAAAAAGAAAT
GTCGATTTTGCTAAAAAAAAAAAAAAAAA
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters