Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00039

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00039:

Expression details for Contig39_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig39_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os04g14760.1, phosphoglycerate mutase, putative, expressed, Expect:4e-98, match=178/236. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi5g03700.1, , Expect:1e-107, match=197/236. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 NP_568040.1 6e-60 (NM_119999) expressed protein; protein id: At4g38370.1, supported by cDNA: 249631. [Arabidopsis thaliana]
Annotation via Blast BLASTX UniProt: UniRef90_C5K9V1, 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, putative n=2 Tax=Perkinsus marinus ATCC 50983 RepID=C5K9V1_PERM5, Expect:2e-15, match=61/176. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA39660_4513, OSJNBb0072N21.7 protein [Oryza sativa (japonica cultivar-group)], Expect:0, match=906/906. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002446116, hypothetical protein SORBIDRAFT_06g001950 [Sorghum bicolor], Expect:1e-101, match=183/236. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os04g14760.1, phosphoglycerate mutase, putative, expressed, Expect:4e-98, match=178/236. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC212577, weakly similar to UniRef100_A7P8P2 Cluster: Chromosome chr3 scaffold_8, whole genome shotgun sequence; n=1; Vitis vinifera|Rep: Chromosome chr3 scaffold_8, whole genome shotgun sequence - Vitis vinifera (Grape), partial (86%), Expect:0, match=955/906. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi5g03700.1, , Expect:1e-107, match=197/236. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G38370.1, | Symbols: | Phosphoglycerate mutase family protein | chr4:17970112-17971222 REVERSE LENGTH=226, Expect:7e-71, match=131/219. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 906
>Barley1_00039
CAAATGGAGGGTTCGAGCGGCGACTCGCCGCCGGCGCCGCCGCCCGCCTTCCGGAACAGG
TACTGGATCCTCCGCCACGGCCGCAGCGTCCCCAACGAGCGCGGCCTCATCGTCTCCTCC
CTGGAGAACGGCACGAAGCCGGAGTTCGGGCTGGCCCCGGAGGGCGTCGAGCAGGCGCGC
TCCGCCGGCGAGTCGCTCCGGAAGGAGCTTGAGGAGATGGGTGTGCCGGTAGACTCTGTC
AAGATCCGGTATTCGCCGTTCTCGCGGACGACAGAGACGGCCAGGGTGGTCGCTGGTGTG
CTGGGCGTCCCATTTGAGGGTCCTAGCTGCAAGGCAACCGTGGAACTTCGTGAACGTTAT
TTTGGACCATCATATGAGTTGCTTTCACACGAGAAGTATGCAGAGGTATGGGCGATAGAT
GAAGCAGATCCCTTTCTGGCTCCAGAAGGTGGGGAGAGTGTTGCAGATGTTGCTAGTAGA
CTTGCAGGGGTGCTGTCTTCTACAGACGTGGAGTTTCATGGCTCTGCTGTTCTTATTGTC
AGCCATGGGGATCCACTACAGATCTTTCAAGCAGTGCTCAGTGGAGCCAAGGAAAACCCA
TCTTTCCTCGACAAGGTAGCTGGCCTGAAAAAGGAAAGCCTGATAGTTCCATCCGTGTTG
TCGCAGCACCGCAAGTTCGCACTCAACACAGGAGAGCTGCGTCGAGTCGTGTGACCCGAC
ACAGATTTGATCATATGCTCATATGTCGTAGATAATTCATGTATCCGTAATTCCTTATGG
AGAGTCTGATAAGATGGAAAAAATGTTGTTCGATGGCACTCCATTATTTTGGTTGATCAG
ATTGAAGATCTGCTTGTAACCGTGAAAAAAGAGCACATGCACAAGAGATTGCTTTTGAAT
TTGATC
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters