Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00003

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00003:

Expression details for Contig3_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig3_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os07g11510.1, RAL6 - Seed allergenic protein RA5/RA14/RA17 precursor, expressed, Expect:4e-19, match=48/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi1g54000.1, , Expect:5e-18, match=49/133. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 P13691 9e-69 ALPHA-AMYLASE INHIBITOR BDAI-I PRECURSOR pir||S00332 alpha-amylase inhibitor precursor (clone pUP-44) - barley
Annotation via Blast BLASTX UniProt: UniRef90_P13691, Alpha-amylase inhibitor BDAI-1 n=3 Tax=Hordeum vulgare RepID=IAA2_HORVU, Expect:7e-62, match=111/123. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
TA30520_4513:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 528/528 100 view
TA30520_4513:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 528/528 100 view
BE602145:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 522/522 100 view
BE602145:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 522/522 100 view
BE603197:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 521/521 100 view
show best hit only

BLASTX NCBI Reference Sequence: NP_001059189, Os07g0215500 [Oryza sativa Japonica Group], Expect:2e-18, match=48/120. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os07g11510.1, RAL6 - Seed allergenic protein RA5/RA14/RA17 precursor, expressed, Expect:4e-19, match=48/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC235364, UniRef100_P13691 Cluster: Alpha-amylase inhibitor BDAI-1 precursor; n=2; Hordeum vulgare|Rep: Alpha-amylase inhibitor BDAI-1 precursor - Hordeum vulgare (Barley), complete, Expect:0, match=751/633. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi1g54000.1, , Expect:5e-18, match=49/133. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: No hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 721
>Barley1_00003
TAATCAAAAATAACCGATAATATTTCTTAAGCCGAAGATAGTAAGAGTGTAGCTACCGAT
CGATATAAGCAACTGATTAAGATAGTAGTAGATGGGAATGGGAGCAATGTGGATGAAGAG
CATGTTGTTGGTGCTCCTGCTATGCATGCTCATGGTGACTCCAATGACGGGCGCACGGAG
TGATAACAGTGGCCCTTGGATGTGGTGTGATCCTGAGATGGGCCACAAGGTGAGCCCGCT
CACGCGCTGCCGAGCATTGGTGAAGCTCGAGTGTGTGGGCAACCGGGTGCCCGAGGATGT
CCTAAGAGACTGCTGCCAGGAGGTGGCCAACATCAGCAACGAGTGGTGCAGGTGCGGCGA
CCTCGGCAGCATGCTGCGCAGCGTGTATGCGGCGCTCGGCGTGGGGGGCGGACCGGAGGA
GGTGTTCCCGGGTTGCCAGAAGGATGTGATGAAGCTCTTGGTTGCAGGCGTGCCTGCGCT
CTGCAATGTCCCCATTCCCAACGAGGCGGCAGGCACCAGAGGGGTCTGCTACTGGTCAGC
GTCTACGGACACCTAGTCAAGCGATTATTATGCTTTTTAATAATTTGTGTGGTGTGTGTG
TGCGCGCACAAGATGAATAAAATGAAATAATGGTGTATCTGCCAAAAAAAAAAAAAAAAA
ATGTATGAACCTGAACTTAATTTAATTTTCCTACTCATAGATAAAAAAAAAAAAAAAAAA
A
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters