Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Barley1 22K
Experiments
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
M. truncatula 50.9K
M. sativa 1.9K
S. meliloti 8.3K
Experiments
Poplar
Rice
Soybean
Sugarcane
Sugarcane 8k
Experiments
Tomato
Tomato
Experiments
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00003

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00003:

Expression details for Contig3_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig3_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os07g11510.1, RAL6 - Seed allergenic protein RA5/RA14/RA17 precursor, expressed, Expect:4e-19, match=48/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi1g54000.1, , Expect:5e-18, match=49/133. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 P13691 9e-69 ALPHA-AMYLASE INHIBITOR BDAI-I PRECURSOR pir||S00332 alpha-amylase inhibitor precursor (clone pUP-44) - barley
Annotation via Blast BLASTX UniProt: UniRef90_P13691, Alpha-amylase inhibitor BDAI-1 n=3 Tax=Hordeum vulgare RepID=IAA2_HORVU, Expect:7e-62, match=111/123. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
TA30520_4513:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 528/528 100 view
TA30520_4513:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 528/528 100 view
BE602145:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 522/522 100 view
BE602145:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 522/522 100 view
BE603197:Alpha-amylase inhibitor BDAI-I precursor [Hordeum vulgare (Barley)] 0 521/521 100 view
show best hit only

BLASTX NCBI Reference Sequence: NP_001059189, Os07g0215500 [Oryza sativa Japonica Group], Expect:2e-18, match=48/120. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os07g11510.1, RAL6 - Seed allergenic protein RA5/RA14/RA17 precursor, expressed, Expect:4e-19, match=48/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC235364, UniRef100_P13691 Cluster: Alpha-amylase inhibitor BDAI-1 precursor; n=2; Hordeum vulgare|Rep: Alpha-amylase inhibitor BDAI-1 precursor - Hordeum vulgare (Barley), complete, Expect:0, match=751/633. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi1g54000.1, , Expect:5e-18, match=49/133. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: No hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 721
>Barley1_00003
TAATCAAAAATAACCGATAATATTTCTTAAGCCGAAGATAGTAAGAGTGTAGCTACCGAT
CGATATAAGCAACTGATTAAGATAGTAGTAGATGGGAATGGGAGCAATGTGGATGAAGAG
CATGTTGTTGGTGCTCCTGCTATGCATGCTCATGGTGACTCCAATGACGGGCGCACGGAG
TGATAACAGTGGCCCTTGGATGTGGTGTGATCCTGAGATGGGCCACAAGGTGAGCCCGCT
CACGCGCTGCCGAGCATTGGTGAAGCTCGAGTGTGTGGGCAACCGGGTGCCCGAGGATGT
CCTAAGAGACTGCTGCCAGGAGGTGGCCAACATCAGCAACGAGTGGTGCAGGTGCGGCGA
CCTCGGCAGCATGCTGCGCAGCGTGTATGCGGCGCTCGGCGTGGGGGGCGGACCGGAGGA
GGTGTTCCCGGGTTGCCAGAAGGATGTGATGAAGCTCTTGGTTGCAGGCGTGCCTGCGCT
CTGCAATGTCCCCATTCCCAACGAGGCGGCAGGCACCAGAGGGGTCTGCTACTGGTCAGC
GTCTACGGACACCTAGTCAAGCGATTATTATGCTTTTTAATAATTTGTGTGGTGTGTGTG
TGCGCGCACAAGATGAATAAAATGAAATAATGGTGTATCTGCCAAAAAAAAAAAAAAAAA
ATGTATGAACCTGAACTTAATTTAATTTTCCTACTCATAGATAAAAAAAAAAAAAAAAAA
A
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters