Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Create a new account
Plants
Pathogens & Symbionts
Submit Experiment Data
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Profile
Groups
Experiments
Download Logs
Documentation
News
Links
Miscellaneous
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00074

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00074:

Expression details for Contig74_x_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig74_x_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os09g17740.1, chlorophyll A-B binding protein, putative, expressed, Expect:2e-16, match=37/38. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi3g42620.1, , Expect:3e-17, match=38/38. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 A24039 7e-16 chlorophyll a/b-binding protein 1A precursor - tomato (fragments) prf||1204205A protein 1A,chlorophyll binding
Annotation via Blast BLASTX UniProt: UniRef90_P14584, Chlorophyll a-b binding of LHCII type 1 protein (Fragment) n=20 Tax=Magnoliophyta RepID=CB21_RAPSA, Expect:3e-15, match=38/38. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: BJ451134, Light harvesting chlorophyll a /b binding protein of PSII [Euglena gracilis], Expect:2e-86, match=161/161. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002881334, chlorophyll A-B-binding protein 2 precursor [Arabidopsis lyrata subsp. lyrata], Expect:4e-16, match=38/38. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os09g17740.1, chlorophyll A-B binding protein, putative, expressed, Expect:2e-16, match=37/38. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: BE422434, homologue to UniRef100_P07370 Cluster: Chlorophyll a-b binding protein 1B, chloroplast precursor; n=1; Solanum lycopersicum|Rep: Chlorophyll a-b binding protein 1B, chloroplast precursor - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), partial (, Expect:1e-86, match=1063/291. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi3g42620.1, , Expect:3e-17, match=38/38. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT2G34420.1, | Symbols: LHB1B2, LHCB1.5 | photosystem II light harvesting complex gene B1B2 | chr2:14522716-14523513 REVERSE LENGTH=266, Expect:4e-17, match=38/38. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 330
>Barley1_00074
CTTCGTCCAGGCCATCGTCACCGGCAAGGGCCCCCTCGAGAACCTCGCCGACCACCTCGC
CGACCCCGTCAACAACAACGCCTGGGCCTTCGCCACCAACTTCGTCCCCGGCAAGTGAGC
TCAACCTCTAGCGCGCGCGCGCGCGCGCGCGCTTGGCCGACAACTTCATTGCTGATGGAT
GCTGCTGTGCTGCATGTCTTTCCGGACTGATAGATGTTGCATGTGAGGGCGAGTCGAGAT
GATGAGTTGGTGTGTGTACACTAAAAAGATGGTGTTTGTGTAATATCTGGTTATTTTTCA
GATTAACCAAGGCAAAAAAAAAAAAAAAAA
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters