Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
G. max 37.5K
P. sojae 15.8K
H. glycines 7.5K
Experiments
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Fusarium
Magnaporthe grisea
Puccinia graminis
Pyrenophora tritici-repentis
Ustilago maydis
Verticillium dahliae
Phytophthora
Heterodera
Sinorhizobium
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00039

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00039:

Expression details for Contig39_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig39_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os04g14760.1, phosphoglycerate mutase, putative, expressed, Expect:4e-98, match=178/236. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi5g03700.1, , Expect:1e-107, match=197/236. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 NP_568040.1 6e-60 (NM_119999) expressed protein; protein id: At4g38370.1, supported by cDNA: 249631. [Arabidopsis thaliana]
Annotation via Blast BLASTX UniProt: UniRef90_C5K9V1, 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, putative n=2 Tax=Perkinsus marinus ATCC 50983 RepID=C5K9V1_PERM5, Expect:2e-15, match=61/176. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA39660_4513, OSJNBb0072N21.7 protein [Oryza sativa (japonica cultivar-group)], Expect:0, match=906/906. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002446116, hypothetical protein SORBIDRAFT_06g001950 [Sorghum bicolor], Expect:1e-101, match=183/236. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os04g14760.1, phosphoglycerate mutase, putative, expressed, Expect:4e-98, match=178/236. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC212577, weakly similar to UniRef100_A7P8P2 Cluster: Chromosome chr3 scaffold_8, whole genome shotgun sequence; n=1; Vitis vinifera|Rep: Chromosome chr3 scaffold_8, whole genome shotgun sequence - Vitis vinifera (Grape), partial (86%), Expect:0, match=955/906. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi5g03700.1, , Expect:1e-107, match=197/236. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G38370.1, | Symbols: | Phosphoglycerate mutase family protein | chr4:17970112-17971222 REVERSE LENGTH=226, Expect:7e-71, match=131/219. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 906
>Barley1_00039
CAAATGGAGGGTTCGAGCGGCGACTCGCCGCCGGCGCCGCCGCCCGCCTTCCGGAACAGG
TACTGGATCCTCCGCCACGGCCGCAGCGTCCCCAACGAGCGCGGCCTCATCGTCTCCTCC
CTGGAGAACGGCACGAAGCCGGAGTTCGGGCTGGCCCCGGAGGGCGTCGAGCAGGCGCGC
TCCGCCGGCGAGTCGCTCCGGAAGGAGCTTGAGGAGATGGGTGTGCCGGTAGACTCTGTC
AAGATCCGGTATTCGCCGTTCTCGCGGACGACAGAGACGGCCAGGGTGGTCGCTGGTGTG
CTGGGCGTCCCATTTGAGGGTCCTAGCTGCAAGGCAACCGTGGAACTTCGTGAACGTTAT
TTTGGACCATCATATGAGTTGCTTTCACACGAGAAGTATGCAGAGGTATGGGCGATAGAT
GAAGCAGATCCCTTTCTGGCTCCAGAAGGTGGGGAGAGTGTTGCAGATGTTGCTAGTAGA
CTTGCAGGGGTGCTGTCTTCTACAGACGTGGAGTTTCATGGCTCTGCTGTTCTTATTGTC
AGCCATGGGGATCCACTACAGATCTTTCAAGCAGTGCTCAGTGGAGCCAAGGAAAACCCA
TCTTTCCTCGACAAGGTAGCTGGCCTGAAAAAGGAAAGCCTGATAGTTCCATCCGTGTTG
TCGCAGCACCGCAAGTTCGCACTCAACACAGGAGAGCTGCGTCGAGTCGTGTGACCCGAC
ACAGATTTGATCATATGCTCATATGTCGTAGATAATTCATGTATCCGTAATTCCTTATGG
AGAGTCTGATAAGATGGAAAAAATGTTGTTCGATGGCACTCCATTATTTTGGTTGATCAG
ATTGAAGATCTGCTTGTAACCGTGAAAAAAGAGCACATGCACAAGAGATTGCTTTTGAAT
TTGATC
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters