Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Brachypodium
Experiments
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00016

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00016:

Expression details for Contig16_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig16_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os12g34510.1, Core histone H2A/H2B/H3/H4 domain containing protein, putative, expressed, Expect:1e-44, match=94/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi4g06010.1, , Expect:4e-45, match=94/120. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/04/02 NP_175868.1 9e-47 histone H2A, putative; protein id: At1g54690.1, supported by cDNA: 16879., supported by cDNA: gi_15724171, supported by
Annotation via Blast BLASTX UniProt: UniRef90_Q2QPG9, Probable histone H2AXb n=8 Tax=Poaceae RepID=H2AXB_ORYSJ, Expect:3e-43, match=94/120. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA30091_4513, Histone H2A [Chlamydomonas reinhardtii], Expect:0, match=653/653. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002328535, histone 2 [Populus trichocarpa], Expect:2e-44, match=93/120. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os12g34510.1, Core histone H2A/H2B/H3/H4 domain containing protein, putative, expressed, Expect:1e-44, match=94/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC233287, homologue to UniRef100_A2Q3H4 Cluster: Histone H2A; Histone-fold; n=1; Medicago truncatula|Rep: Histone H2A; Histone-fold - Medicago truncatula (Barrel medic), partial (94%), Expect:0, match=761/703. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi4g06010.1, , Expect:4e-45, match=94/120. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT1G54690.1, | Symbols: HTA3, H2AXB, G-H2AX, GAMMA-H2AX | gamma histone variant H2AX | chr1:20414607-20415206 REVERSE LENGTH=143, Expect:4e-45, match=93/120. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 735
>Barley1_00016
CAGCAATCTGTCCGACTCCGGCCATCTCTCCGGCAACCACCGTATCCGCGCGTCCACCAT
CCGTAGCGACCAGAAGATGAGTTCTGCCGGCGGCGGGAGGGGCAAGGCCAAGGCGGCGTC
CAAGATCGTCTCGCGGTCTTCCAAGGCCGGCCTCCAGTTCCCCGTCGGCCGCATCGCCAG
GTACCTCAAGATCGGCAAGTACGCCCAGCGCGTCGGTGCCGGCGCCCCCGTCTACCTCTC
CGCCGTCCTCGAGTACCTCGCCGCTGAGGTCCTGGAGCTCGCCGGCAACGCTGCGCGCGA
CAACAAGAAGACCCGGATCGTGCCGCGCCACATCCAGCTGGCGGTCCGCAACGATGAGGA
GCTGAGTCGGCTTCTGGGCACGGTCACCATTGCCGCCGGCGGTGTGCTGCCCAACATCCA
CACGACGCTGCTCCCCAAGAAAGTCGGCAAGGGCAAGGGCGACATCGGCTCTGCGTCGCA
GGAGTTCTAGAGCCTCGCAGATGAAACCAGCATCATCACAGAAGATTTGAGGACTCTTCT
TTTTCTAGTATGGCGATGCTTTAGGTTGTTAGATTAGTTCTCGGTCAATGCTTTGGTTGG
TGTATCGATGATGAATCTGGTTGGAATGGAATGCTAGCAATCTGGTTCTAGTTAAAAAAA
AAAAAAAATGCTCCTTGTGATATGCCAAATCAAAGTGAAAATATCTTGTTAATCTGGGTA
TGAAAAAAAAAAAAA
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters