Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Gossypium hirsutum
Gossypium raimondii
Experiments
Grape
Maize
Maize Cornchip0 8K
Maize 18K
Maize 58K NSF Array
Maize 100 WT Array
Experiments
Medicago
M. truncatula 50.9K
M. sativa 1.9K
S. meliloti 8.3K
Experiments
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_00016

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_00016:

Expression details for Contig16_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig16_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os12g34510.1, Core histone H2A/H2B/H3/H4 domain containing protein, putative, expressed, Expect:1e-44, match=94/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi4g06010.1, , Expect:4e-45, match=94/120. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/04/02 NP_175868.1 9e-47 histone H2A, putative; protein id: At1g54690.1, supported by cDNA: 16879., supported by cDNA: gi_15724171, supported by
Annotation via Blast BLASTX UniProt: UniRef90_Q2QPG9, Probable histone H2AXb n=8 Tax=Poaceae RepID=H2AXB_ORYSJ, Expect:3e-43, match=94/120. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA30091_4513, Histone H2A [Chlamydomonas reinhardtii], Expect:0, match=653/653. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002328535, histone 2 [Populus trichocarpa], Expect:2e-44, match=93/120. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os12g34510.1, Core histone H2A/H2B/H3/H4 domain containing protein, putative, expressed, Expect:1e-44, match=94/120. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC233287, homologue to UniRef100_A2Q3H4 Cluster: Histone H2A; Histone-fold; n=1; Medicago truncatula|Rep: Histone H2A; Histone-fold - Medicago truncatula (Barrel medic), partial (94%), Expect:0, match=761/703. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi4g06010.1, , Expect:4e-45, match=94/120. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT1G54690.1, | Symbols: HTA3, H2AXB, G-H2AX, GAMMA-H2AX | gamma histone variant H2AX | chr1:20414607-20415206 REVERSE LENGTH=143, Expect:4e-45, match=93/120. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 735
>Barley1_00016
CAGCAATCTGTCCGACTCCGGCCATCTCTCCGGCAACCACCGTATCCGCGCGTCCACCAT
CCGTAGCGACCAGAAGATGAGTTCTGCCGGCGGCGGGAGGGGCAAGGCCAAGGCGGCGTC
CAAGATCGTCTCGCGGTCTTCCAAGGCCGGCCTCCAGTTCCCCGTCGGCCGCATCGCCAG
GTACCTCAAGATCGGCAAGTACGCCCAGCGCGTCGGTGCCGGCGCCCCCGTCTACCTCTC
CGCCGTCCTCGAGTACCTCGCCGCTGAGGTCCTGGAGCTCGCCGGCAACGCTGCGCGCGA
CAACAAGAAGACCCGGATCGTGCCGCGCCACATCCAGCTGGCGGTCCGCAACGATGAGGA
GCTGAGTCGGCTTCTGGGCACGGTCACCATTGCCGCCGGCGGTGTGCTGCCCAACATCCA
CACGACGCTGCTCCCCAAGAAAGTCGGCAAGGGCAAGGGCGACATCGGCTCTGCGTCGCA
GGAGTTCTAGAGCCTCGCAGATGAAACCAGCATCATCACAGAAGATTTGAGGACTCTTCT
TTTTCTAGTATGGCGATGCTTTAGGTTGTTAGATTAGTTCTCGGTCAATGCTTTGGTTGG
TGTATCGATGATGAATCTGGTTGGAATGGAATGCTAGCAATCTGGTTCTAGTTAAAAAAA
AAAAAAAATGCTCCTTGTGATATGCCAAATCAAAGTGAAAATATCTTGTTAATCTGGGTA
TGAAAAAAAAAAAAA
 
Copyright@2001-2009 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters